Journal:

Article Title: Diverse Restriction Fragment Length Polymorphism Patterns of the PCR-Amplified 16S rRNA Genes in Aeromonas veronii Strains and Possible Misidentification of Aeromonas Species

doi:

Figure Lengend Snippet: Aeromonas reference strains used in this study

Article Snippet: The Aeromonas strains were grown on sheep blood agar at 30°C ( 11 ). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Species Strain a A. hydrophila A 82, A 162, AER 4, AER 19, ATCC 7966 T A. bestiarum A 307, A 310, ATCC 14715, NCMB 1134 A. salmonicida A 8, A 14, A 63, A 99, A 132, CDC0434-84 A. caviae A 12, A 26, AER 5, AER 51, ATCC 15468 T A. media A 6, A 81, A 117, A 225, A 284, A 912, CDC0862-83 (5a), CDC0435-84 (5b) A. eucrenophila A 1651, A 1653, ATCC 23309 T A. sobria A 915, CIP 7433 T A. veronii biovar sobria A 64, A 132, A 155, A 916, AER 28, AER 39, CDC0437-84, LMG 13694 (A 27), LMG 13695 (A 28) A. jandaei A 950, AER 14, ATCC 49568 T , NMR1-6 A. veronii biovar veronii AER 397, ATCC 35624 T , LMG 16334 (ATCC 35625) A. encheleia ATCC 35941, ATCC 43946, LMG 13076, LMG 16328, LMG 16329, LMG 16330 T A. schubertii ATCC 43700 T , LMG 12655, LMG 12668 A. trota AER 66, AER 370, ATCC 49657 T A. allosaccharophila LMG 14021, LMG 14059 T Open in a separate window a Strains were identified by DNA-DNA hybridization by other investigators.

Techniques:

Journal: bioRxiv

Article Title: Optimizing nucleic acid extraction and transcriptome evaluation from low-input, fixed clinical samples

doi: 10.1101/2020.06.02.122150

Figure Lengend Snippet: A. Representative traces from the Agilent Bioanalyzer (High Sensitivity DNA chip) assessment of post-hybridization libraries prepared from the PT0017bx RNA (either Covaris or QIAGEN) and either the Agilent SureSelect XT RNA Direct or XT HS RNA Alpha library preparation kits. B. The average size of dsDNA molecules (top panel; y-axis) was quantified by the Agilent Bioanalyzer for each library (x-axis), and the total number of reads generated for each library (bottom panel; y-axis) was quantified using samtools flagstat tool. The fill color of each bar indicates the library preparation kit; each input quantity is separated along the x-axis; the transparency of the bars for the number of reads generated shows aligned and unaligned reads.

Article Snippet: Libraries were prepared with varied input quantities from both the Covaris-extracted RNA from PT0017bx, QIAGEN-extracted RNA from PT0017bx, and the Agilent Universal Human Reference (UHR) RNA using the Agilent SureSelect XT HS RNA Alpha (20ng, 50ng, 100ng), Agilent SureSelect XT RNA Direct (100ng, 200ng), and the Illumina TruSeq RNA Exome (20ng, 50ng, 100ng).

Techniques: Hybridization, Generated

Journal: bioRxiv

Article Title: Optimizing nucleic acid extraction and transcriptome evaluation from low-input, fixed clinical samples

doi: 10.1101/2020.06.02.122150

Figure Lengend Snippet: A. Correlation of gene expression (library size-normalized counts across all genes) between libraries. B. PCA plot showing the clustering of points based upon library preparation (color/outline), input quantity (shape), and extraction protocol (grey vs. opaque). C. PC1 loading values of individual genes (x-axis) are shown as both density and point plots. Points are colored based upon whether the gene falls within the targeted genomic region of either Agilent, Illumina, or both exome capture probesets. (D) Differential expression analysis was performed on PC2-low (Covaris-extracted RNA and AgilentSureSelect XT HS or Illumina TruSeq RNA Exome libraries) versus PC2-high (QIAGEN-extracted RNA and/or Agilent SureSelect XT RNA Direct libraries). Genes were filtered to the genes in the top and bottom 1% of PC2 loadings (from panel B; n=706 genes). The volcano plot shows the q value, Log2-fold change (x-axis), comparing PC2-low versus PC2-high, and the PC2 loading value of the corresponding points. The heatmap shows the Log2-library-normalized expression of the genes in the bottom 1% of PC2 loadings (n=353; y-axis) per library (x-axis, indicated by the color/point shown in panel B).

Article Snippet: Libraries were prepared with varied input quantities from both the Covaris-extracted RNA from PT0017bx, QIAGEN-extracted RNA from PT0017bx, and the Agilent Universal Human Reference (UHR) RNA using the Agilent SureSelect XT HS RNA Alpha (20ng, 50ng, 100ng), Agilent SureSelect XT RNA Direct (100ng, 200ng), and the Illumina TruSeq RNA Exome (20ng, 50ng, 100ng).

Techniques: Expressing

Journal: American journal of human genetics

Article Title: DCDC2 mutations cause a renal-hepatic ciliopathy by disrupting Wnt signaling.

doi: 10.1016/j.ajhg.2014.12.002

Figure Lengend Snippet: Figure 1. Homozygosity Mapping and WES Detect DCDC2 Mutations in Individuals with Renal-Hepatic Ciliopathy (A) In A3547-22 with a renal-hepatic ciliopathy renal histology (left panel; Masson trichrome staining) reveals tubulointerstitial fibrosis and tubular dilation with epithelial luminal budding (arrowhead). Hepatic histology (right panel; H&E staining) of A3547-22 shows areas of florid fibrosis with destruction of bile ducts, focal ductular proliferation with cholestasis, and bile plugging. (B) For individual A3547-22 nonparametric LOD (NPL) scores from whole-genome mapping are plotted across the human genome. The x axis shows Affymetrix 250K StyI array SNP positions on human chromosomes concatenated from pter (left) to qter (right). Genetic dis- tance is given in cM. Eight maximum NPL peaks (red circles) indicate candidate regions of homozygosity by descent. Note that the DCDC2 locus (arrow head) is positioned within a maximum NPL peaks on chromosome 6p. (C) Exon structure of human DCDC2 cDNA. Positions of start codon (ATG) and stop codon (TGA) are indicated. (D) Protein domain structure of DCDC2. The N terminus contains two doublecortin domains.

Article Snippet: Additional 21 individuals with early onset liver fibrosis were Sanger sequenced for coding regions of DCDC2 (Table S3). cDNA and Splice Mutation RNA of A4435-21 and healthy control was purified from whole blood, cDNA was synthesized (Agilent Technologies) and Sanger 82 The American Journal of Human Genetics 96, 81–92, January 8, 20 sequenced, using primers flanking exon 4 in order to confirm skipping of exon 4 (Figure S1; Table S3). cDNA Cloning Human full-length (Hs-FL) DCDC2 cDNA was subcloned by PCR from Hs-FL cDNA (origene SC114336).

Techniques: Staining

Journal: American journal of human genetics

Article Title: DCDC2 mutations cause a renal-hepatic ciliopathy by disrupting Wnt signaling.

doi: 10.1016/j.ajhg.2014.12.002

Figure Lengend Snippet: Figure 4. MO Knockdown of dcdc2b Rep- licates Ciliopathy Phenotypes in Zebrafish that Cannot Be Rescued by cDNA Clones Representing Human Ciliopathy Mutants (A) Zebrafish embryos injected with AUGMO at one-cell stage produced defects characteristic of cilia dysfunction. Lateral view of 2-day-old control and morphant embryos. dcdc2b morphant developed ventrally bent body axis, hydrocephalus, tail kinks, and pericardial edema (‘‘full ciliopathy phenotype’’). Morphologically visible ciliopathy phenotypes in dcdc2b morphants were completely or partially rescued (lacking at least one phenotype) by coinjection of 50capped mRNA of WT human DCDC2. Coinjection of AUGMO with capped mRNA of either of the two human DCDC2 mutant clones hDCDC2_Lys217* or hDCDC2_Ser42Glnfs*72 mostly failed to rescue ciliary defects. Scale bar is 100 mm. (B) Histological sections of pronephros from control and morphant embryo at 3.5 dpf. dcdc2b morphants clearly showed dila- tion of the pronephric duct (asterisks) compared to control embryos. (C) Transverse brain sections shows hydro- cephalus (asterisk) in dcdc2b morphants as compared to control brain sections (methy- lene blue and silver stain). (D) Left-right asymmetry defects in liver, gut, and pancreas as visualized by in situ hybridization for the expression of foxa3 with quantitation by histogram (li, liver; pa, pancreas; g, gut). Scale bar is 50 mm. (E) Treatment with b-catenin inhibitor iCRT14 within the dose range of 0.5–1 mM rescued dcdc2b knockdown ciliopathy phe- notypes in the morphants. Histograms are representation of two or three independent experiments.

Article Snippet: Additional 21 individuals with early onset liver fibrosis were Sanger sequenced for coding regions of DCDC2 (Table S3). cDNA and Splice Mutation RNA of A4435-21 and healthy control was purified from whole blood, cDNA was synthesized (Agilent Technologies) and Sanger 82 The American Journal of Human Genetics 96, 81–92, January 8, 20 sequenced, using primers flanking exon 4 in order to confirm skipping of exon 4 (Figure S1; Table S3). cDNA Cloning Human full-length (Hs-FL) DCDC2 cDNA was subcloned by PCR from Hs-FL cDNA (origene SC114336).

Techniques: Knockdown, Clone Assay, Injection, Produced, Control, Mutagenesis, Silver Staining, In Situ Hybridization, Expressing, Quantitation Assay

Journal: eLife

Article Title: Notch controls the cell cycle to define leader versus follower identities during collective cell migration

doi: 10.7554/elife.73550

Figure Lengend Snippet: Figure 10. Leader and follower cells progress through the cell cycle at different rates. (A) Selected frames from in vivo imaging of Sox10:Kalt4 embryos from 16 to 28 hpf injected with PCNA-GFP mRNA. White arrow points to cycling cell. Time in minutes. (B) Quantification of the cell cycle total duration in leaders (n = 20, seven embryos) and followers (n = 19, seven embryos; unpaired t-test, p=0.5240). (C) Quantification of the cell cycle phases duration in leaders (G1 n = 45, S n = 44, G2 n = 33 and M n = 32, 11 embryos) and followers (G1 n = 50, S n = 48, G2 n = 33 and M n = 34, 11 embryos). Brown–Forsythe and Welch’s ANOVA tests, G1 p<0.0001, S p<0.0001, G2 p=0.9997, M p=0.9231. (D) Schematic representation of the cell cycle phases durations.

Article Snippet: Reagent type (species) or resource Designation Source or reference Identifiers Additional information Genetic reagent (Danio rerio) Sox10:mG; Tg(–4.9sox10: Hsa.HIST1H2BJmCherry- 2A- GLYPI- EGFP) Richardson et al., 2016 ZDB- TGCONSTRCT171205- 3 Genetic reagent (D. rerio) Sox10:Fucci; Tg(–4.9sox10:mAGFP- gmnn- 2AmCherry- cdt1) Rajan and Gallik, 2018 ZDB- TGCONSTRCT190118- 1 Genetic reagent (D. rerio) hs:dnSu(H); vu21Tg (hsp70l:XdnSu(H)- myc) Latimer et al., 2005 ZDB- ALT- 050519- 2 Genetic reagent (D. rerio) hs:Gal4; kca4Tg Tg(hsp70l:Gal4)1.5kca4 (1) Scheer and Campos- Ortega, 1999 ZDB- ALT- 020918- 6 Genetic reagent (D. rerio) UAS:NICD; Tg(UAS:myc- Notch1a- intra) kca3Tg Scheer and Campos- Ortega, 1999 ZDB- ALT- 020918- 8 Genetic reagent (D. rerio) Tg(UAS:dnSu(H)) This paper Transgenic line details are in materials and methods Genetic reagent (D. rerio) Sox10:Kalt4; Tg(–4.9sox10: Hsa.HIST1H2BJmCherry- 2A- Kalt4ER) Alhashem et al., 2021 Genetic reagent (D. rerio) Tg(h2afva:GFP)kca13 Pauls et al., 2001 ZDB- ALT- 071217- 3 Genetic reagent (D. rerio) Gt(FoxD3:mCherry)ct110aR Hochgreb- Hägele and Bronner, 2013; Lukoseviciute et al., 2018 ZDB- FISH- 150901- 9571 Antibody Anti- myosin heavy chain (mouse monoclonal) Developmental Studies Hybridoma Bank F59 IF (1:200) Antibody Anti- synaptotagmin 2 (mouse monoclonal) Developmental Studies Hybridoma Bank Znp1 IF (1:50) Antibody Anti- acetylated tubulin (mouse monoclonal) Sigma- Aldrich Clone 6- 11B- 1; Cat# MABT868 IF (1:1000) Antibody Anti- digoxigenin- AP (sheep polyclonal) Sigma- Aldrich Cat# 11093274910 IF (1:2000) Antibody Anti- GFP (chicken polyclonal) Merck Millipore Cat# 06- 896 IF (1:750) Antibody Anti- RFP (rabbit polyclonal) MBL Cat# PM005 IF (1:750) Antibody Myc- Tag (mouse monoclonal) Cell Signaling Clone 9B11; Cat# 2276S IF (1:1000) Antibody Anti- GFP (chicken polyclonal) Thermo Fisher Cat# A10262 IF (1:750) Recombinant DNA reagent PCNA- GFP Addgene Cat# 105942 Leung et al., 2011 Sequence- based reagent UAS:NICD F UAS:NICD R This paper Genotyping primer CATCGCGTCTCAGCCTCAC CGGA ATCG TTTA TTGG TGTCG 500 bp band Sequence- based reagent UAS:dnSu(H) F UAS:dnSu(H) R This paper Genotyping primer GCGGTGTGTGTACTTCAGTC TCTCCCCAAACTTCCCTGTC 409 bp band Sequence- based reagent hs:dnSu(H) F hs:dnSu(H) R This paper Genotyping primer CGGG CATT TACT TTAT GTTGC TGCA TTTC TTGC TCAC TGTTTC 1 kb band Commercial assay or kit RNAscope Multiplex Fluorescent kit Bio- Techne Cat# 320850 Commercial assay or kit mMESSAGE mMACHINE SP6 Transcription Kit Thermo Fisher Cat# AM1340 Alhashem et al. eLife 2022;11:e73550.

Techniques: In Vivo Imaging, Injection